 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circUBXN7 | |||
| Gene | UBXN7 | Organism | Human |
| Genome Locus | chr3:196118683-196129890:n/a | Build | hg19 |
| Disease | Bladder Cancer | ICD-10 | Malignant neoplasm of Bladder, unspecified (C67.9) |
| DBLink | Link to database | PMID | 30312173 |
| Experimental Method | |||
| Sample Type | Tissues and Cell lines | Comparison | 84 cases of BC tissues including 30 paired BC tissues and adjacent nontumor tissues and All cell lines including 293T, human immortalized uroepithelium cell SV-HUC-1 and human BC T24 and UM-UC-3 were purchased from ATCC |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward CCACCCATTGATTTGATGC ReverseCCGTCGTCTTTTAGGAGCAC | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Liu, H, Chen, D, Bi, J, Han, J, Yang, M, Dong, W, Lin, T, Huang, J (2018). Circular RNA circUBXN7 represses cell growth and invasion by sponging miR-1247-3p to enhance B4GALT3 expression in bladder cancer. Aging (Albany NY), 10, 10:2606-2623. | |||